DNA Coding
Given the following DNA sequence, sequence the piece of RNA that was coded from this gene:
5' ATCGTAACGATAAACGTACGGTGCTAGCTTT 3'
Input your answer as a number where A=1, C=2, G=3, T=4, and U=5. Do not include the 5' and 3' ends.
The answer is 5132155325155532153221232523111.
This section requires Javascript.
You are seeing this because something didn't load right. We suggest you, (a) try
refreshing the page, (b) enabling javascript if it is disabled on your browser and,
finally, (c)
loading the
non-javascript version of this page
. We're sorry about the hassle.
0 solutions
No explanations have been posted yet. Check back later!